The cultures were extensively washed with HBSS, trypsinized, resuspended in DMEM plus 10% FBS medium, counted and plated in 96-well plates to determine the toxicity of 7-DHC oxysterol mixture

The cultures were extensively washed with HBSS, trypsinized, resuspended in DMEM plus 10% FBS medium, counted and plated in 96-well plates to determine the toxicity of 7-DHC oxysterol mixture. that antioxidant supplementation may be extremely valuable for the treatment of this devastating disease. Keywords:7-dehydrocholesterol, oxysterol, cortical neurons, Smith-Lemli-Opitz Celecoxib Syndrome == INTRODUCTION == Cholesterol is an essential structural component of the central nervous system (CNS). Compared to the rest of the body, the brain contains proportionally the highest amount of cholesterol1. However, cholesterol shows a highly regional distribution in the CNS, with the highest expression observed in the hippocampus and cortex2. Smith-Lemli-Opitz Syndrome (SLOS) is a developmental disorder that arises from mutations in the gene encoding 7-dehydrocholesterol reductase (DHCR7), the last step in the cholesterol biosynthesis pathway3,4. The mutation leads to reduced levels of cholesterol, and accumulation of 7-dehydrocholesterol (7-DHC),3,4which is an extremely reactive compound toward free radical oxidation5,6. As a result, 7-DHC is oxidized, giving rise to a number of metabolites, namely oxysterols6. One of these metabolites, 3,5-dihydroxycholest-7-en-6-one (DHCEO)7(Figure 1), shows significant accumulation in fibroblasts of SLOS patients and in the brain of a SLOS mouse model7,8, raising the possibility that it might significantly contribute to SLOS pathophysiology in the brain of patients. == Figure 1. Structure and expression of cholesterol, 7-dehydrocholesterol and Celecoxib DHCEO in WT andDhcr7-KO mouse brain tissue. == A)Chemical structure of cholesterol, immediate cholesterol precursor 7-DHC, and DHCEO, which is derived from 7-DHC by oxidation.B)Expression of cholesterol, 7-DHC, and DHCEO levels in cortex, midbrain, hippocampus and cerebellum in E20 mouse brain tissue. 7-DHC levels < 0. 2 g/mg in WT are consistent with previously published measurements of 7-DHC in the mouse brain tissue18,19. DHCEO level in WT tissue was below the limit of detection for LC/MS (less than 2 ng). Note the high, but variable levels of 7-DHC and DHCEO across the various brain regions of theDhcr7-KO mice. The regional differences in 7-DHC, DHCEO and their physiological effects on brain development/function are not Celecoxib known to date. To better understand the mechanism by which 7-DHC and Celecoxib its metabolite, DHCEO might contribute to the altered development and brain dysfunction in SLOS, we undertook a series of studies. We determined the distribution of cholesterol, 7-DHC and DHCEO across various brain regions and followed that by assessment of DHCEO effects on neuronal and glial cells. == MATERIALS AND METHODS == Dhcr7-KO Mice Dhcr7-KO (Dhcr7tm1Gst/J) mice were purchased from Jackson Laboratories (catalogue # 007453). The mice were kept and bred in Division of Animal Care facilities at the Vanderbilt University. For analysis of different brain regions embryos were dissected from pregnant females at E20 and the tail was removed from each embryo for genotyping. The genomic DNA from mouse tails was extracted using REDExtract-N-Amp Tissue PCR kit (Sigma-Aldreich). Genotyping was performed using the following PCR primers: forward -ggatcttctgagggcagcctt, reverse - tctgaacccttggctgatca, neo: ctagaccgcggctagagaat. Embryonic heads were removed, brains and specific brain regions dissected and instantly frozen in pre- cooled 2-methylbutane (on dry ice) and stored at -80C until lipid extraction. All procedures were performed Mouse monoclonal to STYK1 in accordance with the Guide for the Humane Use and Care of Laboratory Animals. The use of mice in this study was approved by the IACUC of the Vanderbilt University. == Primary Neuronal and Astrocytic Cultures == Primary cortical neuronal cultures were prepared from E18 brain tissue as previously described2. Briefly, the brain was isolated and the cortex dissected in pre-cooled dissection solution (HBSS). The cortex was cut into tiny pieces and incubated in Trypsin/EDTA for 20-30 min at 37C. Trypsin was inactivated by adding DMEM medium with 10% FBS (Thermo Scientific HyClone, Logan, UT). Tissue was centrifuged at 80 gfor 5 min and then rinsed with 5 ml of DMEM plus 10% FBS two times. After the second rinse, the.