For the tumor formation assay, control shRNA (sh\ctrl) and sh\LINC00525 transfected A549 cells (5 106 cells in 200 L medium/PBS) were subcutaneously injected into the flank of each mouse

For the tumor formation assay, control shRNA (sh\ctrl) and sh\LINC00525 transfected A549 cells (5 106 cells in 200 L medium/PBS) were subcutaneously injected into the flank of each mouse. reverse transcription polymerase chain reaction (RT\qPCR) and in situ hybridization (ISH). The functional role of LINC00525 in LUAD was investigated using gain\and loss\of\function approaches, both and promoter through an formation of RNA\DNA triplex with the promoter, leading to increased trimethylation of lysine 27 on histone 3 (H3K27me3) of the promoter. In addition, LINC00525 repressed expression post\transcriptionally by enhancing mRNA decay. LINC00525 promoted mRNA decay by competitively binding to RNA Binding Motif Single Stranded Interacting Protein 2 (RBMS2). Conclusion Our findings demonstrate that LINC00525 promotes the progression of LUAD by reducing the transcription and stability of mRNA in concert with EZH2 and RBMS2, thus suggesting that LINC00525 may be a potential therapeutic target for clinical intervention in LUAD. mRNA stability analysis, A549 cells were incubated with 5 g/mL actinomycin D (ActD; Sigma\Aldrich, St. Louis, MO, USA) for the indicated time periods (2, 4, 8 and 12 h). For P21 protein stability analysis, A549 cells were incubated with 50 g/mL cycloheximide (CHX) (Sigma\Aldrich, St. Louis, MO, USA) for the indicated time periods (2, 4, 8 LP-935509 and 12 h). 2.2. Tissue samples Human LUAD tissues and paired adjacent normal tissues were collected from the Jiangsu Cancer Hospital (Jiangsu Institute of Cancer Research, Nanjing Medical University affiliated Cancer Hospital Nanjing, Jiangsu, China). LP-935509 All samples were obtained from surgical resection of patients with LUAD (stage I\ IV) and reviewed by experienced pathologists at the Jiangsu Cancer Hospital. Specimens were collected, immediately frozen in liquid nitrogen after surgery, and stored at \80C until use. A total of 92 pairs of LUAD and adjacent normal tissues were used to construct a tissue microarray (TMA) as described previously [22]. Thirty pairs of LUAD tissues and adjacent normal tissues were used to extract RNA. Written informed consent was obtained from all the subjects. The study protocol was approved by the Ethics Committee of the Nanjing Medical University, China. 2.3. RNA chromogenic in situ hybridization (CISH) RNA CISH was performed to analyze LINC00525 expression in TMA using a digoxigenin\labeled probe (5’\GCCAAGGACCGAAGAGGAAATTGAACGA\3′). Briefly, the sections were dewaxed and rehydrated, digested with proteinase K, fixed in 4% paraformaldehyde, and hybridized with the digoxin\labeled probe overnight at 55C. The samples were then incubated at 4C overnight with an anti\digoxin mAb (Roche, St Louis, MO, USA). Sections were stained with nitro blue tetrazolium/5\bromo\4\chloro\3\indolylphosphate (NBT/BCIP) in the dark, mounted, and observed. 2.4. Immunohistochemical (IHC) Serial paraffin\embedded tissues (4 m thick) were de\waxed and rehydrated. Antigen retrieval was conducted in a pressure cooker for 5 min in 10 mM Tris containing 1 mM EDTA (pH 9). The sections were incubated with antibodies specific for Ki 67 (1:200, Servicebio, Wuhan, Hubei, China), P21 (1:200; Cell Signaling Technology, Danvers, Massachusetts), Cylcin D1 (1:200; Cell PPARgamma Signaling Technology, Danvers, Massachusetts) at 4C, the immunodetection was then performed with DAB (diaminobenzidine) on the following day. 2.5. Fluorescence in situ hybridization (FISH) Fluorescence in situ hybridization (FISH) assay was performed using a fluorescent in situ hybridization kit (RiboBio, Guangzhou, Guangdong, China) according to the manufacture’s protocol. Briefly, A549 cells were fixed in 4% formaldehyde for 20 min and washed with PBS. The cells were then incubated with FISH probe in hybridization buffer. DAPI LP-935509 was used for counterstaining the nuclei, and images were obtained with microscopy. 2.6. Plasmid construction and transfection The full\length and antisense cDNA of human LINC00525 and short hairpin RNAs (shRNAs) targeting LINC00525 were synthesized and cloned into the pcDNA3.1 expression vector (Realgene, Nanjing, Jiangsu, China). Cells were transfected with promoter (\1 to \2000) and its mutants (\1 to \299), (\300 to \999), and (\1000 to \2000), were synthesized and cloned into the PGL3\basic LP-935509 luciferase reporter plasmid (Realgene, Nanjing, Jiangsu, China). To construct the pcFLuc\3’UTR reporter plasmid, the 3’UTR region or AU\rich element.